View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4530-Insertion-6 (Length: 267)
Name: NF4530-Insertion-6
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4530-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 7 - 112
Target Start/End: Complemental strand, 42800094 - 42799989
Alignment:
| Q |
7 |
agatacatatgtcacttgtcaattcaattatttcactttcagaataaaaatgaggaaaagatcaaaagacatatgaatctaaaatttacaatcaattttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800094 |
agatacatatgtcacttgtcaattcaattatttcactttcagaataaaaatgaggaaaagatcaaaagacatatgaatctaaaatttacaatcaattttt |
42799995 |
T |
|
| Q |
107 |
gtactt |
112 |
Q |
| |
|
|||||| |
|
|
| T |
42799994 |
gtactt |
42799989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 218 - 267
Target Start/End: Complemental strand, 42799982 - 42799933
Alignment:
| Q |
218 |
acagtgttttcatatctaaaaatgatatgatacctgttctatttaagtga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799982 |
acagtgttttcatatctaaaaatgatatgatacctgttctatttaagtga |
42799933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University