View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4530-Insertion-7 (Length: 68)
Name: NF4530-Insertion-7
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4530-Insertion-7 |
 |  |
|
| [»] scaffold0141 (1 HSPs) |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0141 (Bit Score: 57; Significance: 1e-24; HSPs: 1)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 31816 - 31756
Alignment:
| Q |
8 |
cggtggaagtttttggatttgaagttgctaggatttatgattttaggtttctggaatttga |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31816 |
cggtggaagtttttggatttaaagttgctaggatttatgattttaggtttctggaatttga |
31756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 57; Significance: 1e-24; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 82996 - 83056
Alignment:
| Q |
8 |
cggtggaagtttttggatttgaagttgctaggatttatgattttaggtttctggaatttga |
68 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82996 |
cggtggaagtttttggatttaaagttgctaggatttatgattttaggtttctggaatttga |
83056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University