View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4530_high_8 (Length: 252)
Name: NF4530_high_8
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4530_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 50439891 - 50439666
Alignment:
| Q |
18 |
taaactggtctaaaagtggaatgaacttgataggatccacttttttctttagaaagttttccatggtagattgatgagcaatgatcgatgagaaatataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50439891 |
taaactggtctaaaagtggaatgaacctgataggatccatttttttctttagaaagttttccatggtagattgatgaccaatgatcgatgagaaatataa |
50439792 |
T |
|
| Q |
118 |
attcaatttgactgctgaccacaaccgtcctagttgccactaggatcctgaatctaatatgcgcatcttgcgagattgtgatgaagcaataaaattttgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50439791 |
attcaatttgactgctgaccacaaccatcctagttgccactaggatcccgaatctaatatgcgcatcttgcgagattgtgatgaagctataaaattttgg |
50439692 |
T |
|
| Q |
218 |
tccccaatcatcaaaccatattattg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
50439691 |
tccccaatcatcaaaccatattattg |
50439666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University