View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4530_high_9 (Length: 238)
Name: NF4530_high_9
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4530_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 36060146 - 36060339
Alignment:
| Q |
1 |
agatccggccccaagaagaaccatctttcnnnnnnnnntgttgtagaagaaccaaatgtgacatggaagataagcaatttatcattaaaatagactttat |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36060146 |
agatccggccccgagaagaaccatctttcaaaaaaaa-tgttgtagaagaaccaaatgtgacatggaagacaagcaatttatcattaaaatagactttat |
36060244 |
T |
 |
| Q |
101 |
ttaatgtcactatttgtccatcccttctcaatacaaaagagactagaaaaatagatggcatgtttgggctgtggatctcaaatttgtattttgga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36060245 |
ttaatgtcactatttgtccatcccttctcaatacagaagagactagaaaaatagatggcatgtttgggctgtggatttcaaatttgtattttgga |
36060339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University