View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4530_high_9 (Length: 238)

Name: NF4530_high_9
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4530_high_9
NF4530_high_9
[»] chr2 (1 HSPs)
chr2 (1-195)||(36060146-36060339)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 36060146 - 36060339
Alignment:
1 agatccggccccaagaagaaccatctttcnnnnnnnnntgttgtagaagaaccaaatgtgacatggaagataagcaatttatcattaaaatagactttat 100  Q
    |||||||||||| ||||||||||||||||         |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
36060146 agatccggccccgagaagaaccatctttcaaaaaaaa-tgttgtagaagaaccaaatgtgacatggaagacaagcaatttatcattaaaatagactttat 36060244  T
101 ttaatgtcactatttgtccatcccttctcaatacaaaagagactagaaaaatagatggcatgtttgggctgtggatctcaaatttgtattttgga 195  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
36060245 ttaatgtcactatttgtccatcccttctcaatacagaagagactagaaaaatagatggcatgtttgggctgtggatttcaaatttgtattttgga 36060339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University