View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4530_low_4 (Length: 356)
Name: NF4530_low_4
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4530_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 7377235 - 7377456
Alignment:
| Q |
12 |
atgtgagcccaaccataatttataagaggcataatagacttggtcattctcatgcaaaagttgttaaatcagttatgcaactatacaaaacatctttcat |
111 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7377235 |
atgtgagcccaactataatttctaagaggcataatagacttggtcattctcatgcaaaagttgttaaatcagttatgcaactatacaaaacatctttcat |
7377334 |
T |
|
| Q |
112 |
caataaaaatgtttctatgttgtgtcatgcctaggtaaatctcgca--------nnnnnnnngctttactatttgtttcagcatattcgaagctctcaaa |
203 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||| ||| |
|
|
| T |
7377335 |
caataaaaatgtgtctatgttatgtcatgcctaggtaaatctcgcattttttttttttttttgctttactatttgtttca-catatttgaagctcttaaa |
7377433 |
T |
|
| Q |
204 |
gttattcatgctcatcaccattg |
226 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7377434 |
gttattcatgctcatcaccattg |
7377456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 236 - 346
Target Start/End: Original strand, 7377554 - 7377664
Alignment:
| Q |
236 |
ctttcaagcactccaacaaatttttaagttcattcacactaaatttttaatcaatattaaagatgttcaaagtgatttgggaggtgaactttgtcatttt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7377554 |
ctttcaagcactccaacaaatttttaagttcattcacactaaatttttaatcaatattaaagatgttcaaagtgatttgggaggtgaactttgtcatttt |
7377653 |
T |
|
| Q |
336 |
actaacctttg |
346 |
Q |
| |
|
||||||||||| |
|
|
| T |
7377654 |
actaacctttg |
7377664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University