View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4530_low_5 (Length: 349)
Name: NF4530_low_5
Description: NF4530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4530_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 73 - 332
Target Start/End: Original strand, 26485487 - 26485745
Alignment:
| Q |
73 |
ctgctaatgattgaaagttgaaaattcggccgtggttactttgcaaacctttatattccggaaaaacacggtagattagatgcgggaacacttctaaatg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26485487 |
ctgctaatgattgaaagttgaaaattcggccgtggttactttgcaaacctttatattccagaaaaacgcggtagattagatgcgggaacacttctaaatg |
26485586 |
T |
 |
| Q |
173 |
ttttgttttatgaatgcaggcatgattgaagctagcaatctgaagatggagatgtaaaccagatcttctatcattattttttggatgagctcactccaaa |
272 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26485587 |
ttttattttatgactgcaggcatgattgaagctagcaatctgaagatggagatgtaaaccagatcttctatcattatttgttggatgagctcactccaaa |
26485686 |
T |
 |
| Q |
273 |
tgcttcttatcaaaattctttttctcttaaaagtacagaacatattttggttgtatactg |
332 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26485687 |
tgcttcttaccaaaattctttttctctt-aaagtacataacatattttggttgtatactg |
26485745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 26485425 - 26485459
Alignment:
| Q |
1 |
acagatattgacaagtccttttcatcaaaatgaag |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26485425 |
acagatattgacaagtccttttcatcaaaatgaag |
26485459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University