View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4531_low_6 (Length: 315)
Name: NF4531_low_6
Description: NF4531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4531_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 305
Target Start/End: Complemental strand, 34776744 - 34776463
Alignment:
| Q |
18 |
acccactgtgataaaagacaattgacatttaatttacttatttggttaatccaaaatatgcatcttaatttgttactagttactaccattttatccttat |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
34776744 |
acccactatgataaaagacaattgacatttaatttagttatttggttaatccaaaatat------taatttattactagttactaccattttatccttat |
34776651 |
T |
|
| Q |
118 |
tagcaaaagttatgtaacacagacacttcagattgaaggtaatgtatcctacacattttaatgtctaacattatctcaacatggacacatgttaataaat |
217 |
Q |
| |
|
|||||||||||||||| || ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34776650 |
tagcaaaagttatgtagcagagacacttcggattgaaagtaatgtatcctacacattttaatgtctaacattatctcaacacggacacatgttaataaat |
34776551 |
T |
|
| Q |
218 |
tgaaacaatttcattgactaaatttaattctggtgtctgtgtcattgtcaatattgtatccggtgtgtgcagtgtcagtgtctgtgct |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34776550 |
tgaaacaatttcattgactaaatttaattctggtgtctgtgtcattgtcaatattgtgtccggtgtgtgcagtgtcagtgtctgtgct |
34776463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University