View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4532-Insertion-10 (Length: 300)
Name: NF4532-Insertion-10
Description: NF4532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4532-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 267
Target Start/End: Original strand, 3015291 - 3015550
Alignment:
| Q |
8 |
cattccattagaactcaatgtatttttctccttttcactaatacaaaagcaccgatgaattgcttttttcatttcaaacacaaacttcactctctctttg |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||| |||| |||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3015291 |
cattccattagagctcaatgtatttttctccttttcactgatagaaaaacacccatgaattgcttttttcatttcaaacacaaacttcattctctctttg |
3015390 |
T |
|
| Q |
108 |
aaccacaagcaatggcttcaacaaagaagagaactattatttcagcaatggtttccgctgataagaagctcgagaaggggcttctagaagctggaaacaa |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3015391 |
aaccacaaacaatggcttcaacaaagaagagaactattatttcagcaatggtttccgctgataagaagctcgagaaggagcttctagaagctggaaacaa |
3015490 |
T |
|
| Q |
208 |
gctcttgaatcctccttcttccgtcgataacctgcttcgtcttctaggcgtaaacacact |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015491 |
gctcttgaatcctccttcttccgtcgataacctgcttcgtcttctaggcgtaaacacact |
3015550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University