View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4532-Insertion-13 (Length: 191)
Name: NF4532-Insertion-13
Description: NF4532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4532-Insertion-13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 25545224 - 25545407
Alignment:
| Q |
8 |
aaccatcggagttttactttgcagtttgcgtagaacaagctgtggattctaactagctcttggtgatagtattgattactttctaaagatttgtgttcct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25545224 |
aaccatcggagttttactttgcagtttgcggagaacaagctgtggattctaactagctcttggtgatagtattgattactttctaaagatttgtgttcct |
25545323 |
T |
|
| Q |
108 |
tgaatgatatgccaaggagtctacaactctttgcatacccttatgttaattccataagtcgcagatacaactcttcatccctca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25545324 |
tgaatgatatgccaaggagtctacaactctttgcatacccttatgttaattccataagtcgcagatacaactcttaatccctca |
25545407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 191
Target Start/End: Original strand, 38041406 - 38041465
Alignment:
| Q |
132 |
aactctttgcatacccttatgttaattccataagtcgcagatacaactcttcatccctca |
191 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||| || ||||||||||||| ||||||| |
|
|
| T |
38041406 |
aactctttgcatacccctctgttaattccagaagttgcggatacaactcttcgtccctca |
38041465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University