View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4532-Insertion-14 (Length: 175)
Name: NF4532-Insertion-14
Description: NF4532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4532-Insertion-14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 29243398 - 29243564
Alignment:
| Q |
7 |
aagaagccctgcaagtctctaacgtttcttctgtcaccgccactcgcctacctatcaccatgagttgtgtgctttatgtcaaggttttctattcatgctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29243398 |
aagaagccctgcaagtctctaacgtttcttctgtcaccgccactcgcctacctatcaccatgaattgtgtgctttatgtcaaggttttctattcatgctt |
29243497 |
T |
|
| Q |
107 |
ctttatattcgagtgtttaaataatttcggtcaccctgtttccttttctttcttcataatgttcttcta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29243498 |
ctttatattcgagtgtttaaataatttc-gtca-cctgtttccttttctttcttcatgatgttcttcta |
29243564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University