View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4532-Insertion-16 (Length: 149)
Name: NF4532-Insertion-16
Description: NF4532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4532-Insertion-16 |
 | |
|
| [»] scaffold0189 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0189 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 30084 - 30225
Alignment:
| Q |
8 |
gatcacataggttcaagcaaagacgctaacatctacactgaaatggacatcgacctcaacgatgaagatccatccaacgctgaaatcctcaacgaactcg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30084 |
gatcacataggttcaagcaaagacgctaacatctacactgaaatggacatcgacctcaacgatgaagatccatccaacgctgaaatcctcaacgaactcg |
30183 |
T |
|
| Q |
108 |
gcgaagatatgttcaaatacttttgcaaaaaagcttccgtca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30184 |
gcgaagatatgttcaaatacttttgcaaaagagcttccgtca |
30225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 69; Significance: 3e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 3e-31
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 48883610 - 48883465
Alignment:
| Q |
11 |
cacataggttcaagcaaagacgctaacatc------tacactgaaatggacatcgacct---caacgatgaagatccatccaacgctgaaatcctcaacg |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||| | ||||| ||||||||||| ||||| | |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
48883610 |
cacataggttcaagcaaagatgctaacaacaccaactacacagaaatggacattgaccttgacgacgatgaagatcaatccaacgccgaaatcctcaacg |
48883511 |
T |
|
| Q |
102 |
aactcggcgaagatatgttcaaatacttttgcaaaaaagcttccgt |
147 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| ||||||||||| |
|
|
| T |
48883510 |
aactcggcgacgatatggtcaaatacttttgcaagaaagcttccgt |
48883465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 77 - 145
Target Start/End: Complemental strand, 53014798 - 53014730
Alignment:
| Q |
77 |
ccatccaacgctgaaatcctcaacgaactcggcgaagatatgttcaaatacttttgcaaaaaagcttcc |
145 |
Q |
| |
|
||||| || |||||||||||||||||||| || ||||| ||| ||||||| || ||||||||||||||| |
|
|
| T |
53014798 |
ccatcaaatgctgaaatcctcaacgaactaggtgaagacatggtcaaatatttctgcaaaaaagcttcc |
53014730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University