View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4532_low_5 (Length: 202)
Name: NF4532_low_5
Description: NF4532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4532_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 23553258 - 23553434
Alignment:
| Q |
18 |
ggtttgagcaccagattcttcacttattcatcttgatggtgaattttgagtcactatgttgcttgatnnnnnnnnnntcatgataaactttgttacgtgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
23553258 |
ggtttgagcaccagattcttcacttattcatcttgatggtgaattttgagtcactatattgcttgataaaaaaaaa-tcatgataaactttgttacgtgt |
23553356 |
T |
|
| Q |
118 |
gtgtaaatttggggaaatgcgtggggcatgagttgaaccaaaattgataaagaaaacaataaaaagaaatgatgatgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
23553357 |
gtgtaaatttggggaaatgcgtggggcataagttgaaccaaaattgataaagaaaacaataaaaataaatgatcatgt |
23553434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University