View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533-Insertion-4 (Length: 228)
Name: NF4533-Insertion-4
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533-Insertion-4 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 8 - 228
Target Start/End: Complemental strand, 31975033 - 31974813
Alignment:
| Q |
8 |
tctttcaataaagcctggatgcataactccctcatcacatttcgcctgcaggttacaactacttcgtacaggctttcaaagtgacctcacaattggaatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
31975033 |
tctttcaataaagcctggatgcataactccctcatcacatttcgcctgcaggttacaactactttgtactggctttcaaaacgacctcacaattggaatc |
31974934 |
T |
|
| Q |
108 |
tctccaaataccatcttctgcacatagcagagaaaacattgtttagactttacttgagtagaaacaaaacaaaactgtagaacacaattacaataccatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31974933 |
tctccaaataccatcttctgcacatagcagagaaaacattgtttagactttacttgagtagaaacaaaacaaaactgtagaacacaattacaataccatc |
31974834 |
T |
|
| Q |
208 |
tttatttagatcatctaaagg |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31974833 |
tttatttagatcatctaaagg |
31974813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 82 - 221
Target Start/End: Complemental strand, 31910553 - 31910413
Alignment:
| Q |
82 |
ttcaaagtgacctcacaattggaatctctccaaataccatcttctgcacatagcagagaaaacattgtttagactttacttgagtagaaacaaaacaaaa |
181 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
31910553 |
ttcaaagtgacctcacatttggaatctctccaaataccatcttttgcacataccagagaaaacactctttagattttacttgagtagaaacaaaacaaaa |
31910454 |
T |
|
| Q |
182 |
ctgtagaacacaattacaataccatctt-tatttagatcat |
221 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
31910453 |
ctgtagaacacagttacgataccatcttcgatttagatcat |
31910413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 31912435 - 31912364
Alignment:
| Q |
8 |
tctttcaataaagcctggatgcataactccctcatcacatttcgcctgcaggttacaactacttcgtacagg |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912435 |
tctttcaataaagcctgaatgcataactccctcatcacatttcgcctgcaggttacaactacttcgtacagg |
31912364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University