View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_high_19 (Length: 317)
Name: NF4533_high_19
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 7 - 300
Target Start/End: Original strand, 22061533 - 22061830
Alignment:
| Q |
7 |
ggacatcatcatcatccccagaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctc |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22061533 |
ggacatcatcatcatccccggaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctc |
22061632 |
T |
 |
| Q |
107 |
cactccgataatccttccttcttcgcttcaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22061633 |
cactccgatattccttccttcttcgctccaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtg |
22061732 |
T |
 |
| Q |
207 |
ttggattgtcggcgaacccta----ttaattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattct |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22061733 |
ttggattgtcggcgaaccctattcgttaattatatccaaaatggtgttaacatctttgacaaaatgatcatcccttagatgtaactgattactattct |
22061830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 230 - 300
Target Start/End: Complemental strand, 32904337 - 32904267
Alignment:
| Q |
230 |
aattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattct |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
32904337 |
aattatatccaaaatggtcttaacatctttgacaaaaccatcatcccttaaatgtaactgactactattct |
32904267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University