View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_high_22 (Length: 306)
Name: NF4533_high_22
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 295
Target Start/End: Complemental strand, 38279980 - 38279722
Alignment:
| Q |
17 |
atgtatatatggcacttgatgttggcttttaattagattggaattcttaattagaccccatatataacgtgaattattcgtactagtgcatatgttattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
38279980 |
atgtatatatggcacttgatgttggcttttaattagattggaattcttaattagaccccata----acgtgaattattcgtaccagtgcatatgttattt |
38279885 |
T |
 |
| Q |
117 |
tttgtacggcttttaaaaatgagtaaagtagtaaatttgaggcacaaggggatatatgctttcactttgcaaatttg-cttttat-gttgctttgtctca |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
38279884 |
tttgtacggcttttaaaaatgag------------------gcacaaggggatatatgctttcactttgcaaatttgtcttttattgttgctttgtctca |
38279803 |
T |
 |
| Q |
215 |
ttgagattcttttatcacatacataattgctggacagtatcatctcgaggcatctcaatcctcagtcccgattttcttctt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38279802 |
ttgagattcttttatcacatacataattgctggacagtatcatctcgaggcatctcaatcctcagtcccgattttcttctt |
38279722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University