View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_high_28 (Length: 269)
Name: NF4533_high_28
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 60 - 216
Target Start/End: Complemental strand, 44574912 - 44574756
Alignment:
| Q |
60 |
aaagcaagatatgatgaacatataatagattggtctaaatgttaagaaatttagacttcttaaataagtgatctgaagtttgatctttgactatggaaaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574912 |
aaagcaagatatgatgaacatataatagattggtctaaatgttaagaaatttagacttcttaaataagtgatctgaagtttgatctttgactatggaaaa |
44574813 |
T |
 |
| Q |
160 |
attttgattgagaggggagagtttaacttgtttgctctacaaatttctttatgaaga |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574812 |
aatttgattgagaggggagagtttaacttgtttgctctacaaatttctttatgaaga |
44574756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 50
Target Start/End: Complemental strand, 44574969 - 44574931
Alignment:
| Q |
12 |
atgcgatgtcctatcaacataatatattaatcaatcgaa |
50 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44574969 |
atgcgatgtcctatcaacgtaatatattaatcaatcgaa |
44574931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University