View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4533_high_28 (Length: 269)

Name: NF4533_high_28
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4533_high_28
NF4533_high_28
[»] chr2 (2 HSPs)
chr2 (60-216)||(44574756-44574912)
chr2 (12-50)||(44574931-44574969)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 60 - 216
Target Start/End: Complemental strand, 44574912 - 44574756
Alignment:
60 aaagcaagatatgatgaacatataatagattggtctaaatgttaagaaatttagacttcttaaataagtgatctgaagtttgatctttgactatggaaaa 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44574912 aaagcaagatatgatgaacatataatagattggtctaaatgttaagaaatttagacttcttaaataagtgatctgaagtttgatctttgactatggaaaa 44574813  T
160 attttgattgagaggggagagtttaacttgtttgctctacaaatttctttatgaaga 216  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44574812 aatttgattgagaggggagagtttaacttgtttgctctacaaatttctttatgaaga 44574756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 50
Target Start/End: Complemental strand, 44574969 - 44574931
Alignment:
12 atgcgatgtcctatcaacataatatattaatcaatcgaa 50  Q
    |||||||||||||||||| ||||||||||||||||||||    
44574969 atgcgatgtcctatcaacgtaatatattaatcaatcgaa 44574931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University