View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_high_31 (Length: 244)
Name: NF4533_high_31
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 24925406 - 24925628
Alignment:
| Q |
1 |
tttgaagtactttaattacatccagctatttcttgtttgtgtaatgtgtaatcttttctgaacaacattagcaatacgatccactttcccctttttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24925406 |
tttgaagtactttaattacatccagctatttcttgtttgtgtaatgtgtaatcttttctgaacaacattagcaatacgatccactttcccctttttattt |
24925505 |
T |
 |
| Q |
101 |
ttgactgcggccaagggactaaacattttgatgaaagcaatggttgaaaattaatggttgaaaattatctgtttcatgtgtactcagtgggtatggacaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24925506 |
ttgattgcggccaagggactaaacattttgataaaagc--------------aatggttgaaaattatctgtttcatgtgtactcagtgggtatggacaa |
24925591 |
T |
 |
| Q |
201 |
ttcgatggttgtatcacactttcaatttgttgatgat |
237 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
24925592 |
ttcgatggttgtatgacaccttcaatttattgatgat |
24925628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 78 - 147
Target Start/End: Complemental strand, 6902263 - 6902193
Alignment:
| Q |
78 |
gatccactttcccctttttattt-ttgactgcggccaagggactaaacattttgatgaaagcaatggttga |
147 |
Q |
| |
|
||||||||||||||||||| || ||| | ||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
6902263 |
gatccactttccccttttttgttcttgcttacggccgagggactaaacatattgatgaaagcaatggttga |
6902193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University