View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_low_19 (Length: 361)
Name: NF4533_low_19
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 4314107 - 4314451
Alignment:
| Q |
1 |
cttgcttgtccctggtaattaccaaggagagagaacaataaagcagaaccagacctattatcagcctggtaaacatcgaattaagctgccaactgtggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4314107 |
cttgcttgtccctggtaattaccaaggagagagaacaataaagcagaaccagacctattatcagcctggtaaacatcgaattaagctgccaactgtggga |
4314206 |
T |
 |
| Q |
101 |
gtaaggactacaggaacagttttggtcgagatggttgacaaaaatggactctatttctctgatgaattctctcttacattccatatgcactactataaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4314207 |
gtaaggactacaggaacagttttggtcgagatggttgacaaaaatggactctatttctctgatgaattctctcttacattccatatgcactactataaat |
4314306 |
T |
 |
| Q |
201 |
tgttgaagtggcttcttgttcttccaatgcttgggatgtttggtgtgctggtcatccttcgcccacaaggcccagtgccattgccatcattttcaaggaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4314307 |
tgttgaagtggcttcttgttcttccaatgcttgggatgtttggtgtgctggtcatccttcgcccacaaggcccagtgccattgccatcattttcaaggaa |
4314406 |
T |
 |
| Q |
301 |
caacgattagcgacgattattttgtttcatgctccaggcaccttt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4314407 |
caacgattagcgacgattattttgtttcatgctccaggcaccttt |
4314451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University