View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_low_44 (Length: 242)
Name: NF4533_low_44
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 86 - 164
Target Start/End: Complemental strand, 20631320 - 20631242
Alignment:
| Q |
86 |
gattagccaaaatctaattaagcaacattagctcaaaaataacatatttcaacaattggctttatttagaattttattt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20631320 |
gattagccaaaatctaattaagcaacattagctcaaaaataacatatttcaacaattgcctttatttagaattttattt |
20631242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 20631426 - 20631345
Alignment:
| Q |
10 |
catcatcatttaagtagattgtaatttttgatttattattagaatttagaacccaattcgagttgagatttttatagattag |
91 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20631426 |
catcatcacttaagtagattgtaatttttcatttattattataatttagaacccgattcgagttgagatttttatagattag |
20631345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 86 - 156
Target Start/End: Complemental strand, 20637332 - 20637262
Alignment:
| Q |
86 |
gattagccaaaatctaattaagcaacattagctcaaaaataacatatttcaacaattggctttatttagaa |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
20637332 |
gattagccaaaatctaattaagcaacattagctcaaaaataacatatttcaataattgcctttatttagaa |
20637262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 91
Target Start/End: Complemental strand, 20637438 - 20637357
Alignment:
| Q |
10 |
catcatcatttaagtagattgtaatttttgatttattattagaatttagaacccaattcgagttgagatttttatagattag |
91 |
Q |
| |
|
|||||||| ||||| |||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20637438 |
catcatcacttaagaagattgtaatctttgatttattattataatttagaaccctattcgagttgagatttttatagattag |
20637357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 20637239 - 20637186
Alignment:
| Q |
189 |
ggtagcatatagtccttatatttagacgtacaagttatcataacaaccattcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20637239 |
ggtagcatatagtccttatatttagacgtacaagttatcataacaaccattcat |
20637186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University