View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4533_low_53 (Length: 217)
Name: NF4533_low_53
Description: NF4533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4533_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 31832721 - 31832628
Alignment:
| Q |
1 |
acctcaaaacaatgatccaccaatccaatcctacccatcaaatcctcagcttcagttttcattcagaagactctttcacatcaccccattaaaa |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832721 |
acctcaaaacaatgatccaccaatccaatcctacccatcaaatcctcagcttcagttttcattcagaagactctttcacatcaccccattaaaa |
31832628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 31832568 - 31832515
Alignment:
| Q |
154 |
aactacaacaatacttgaactacgtggtgtcaagaacaatgatggtgatgatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832568 |
aactacaacaatacttgaactacgtggtgtcaagaacaatgatggtgatgatga |
31832515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University