View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4534-Insertion-5 (Length: 199)
Name: NF4534-Insertion-5
Description: NF4534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4534-Insertion-5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 4398955 - 4398768
Alignment:
| Q |
12 |
ctgggttatttcacaaaacccgcaaattaatccctcaacatcaagaatatcccaacgacgaaaaaagatttttatgagtagaggccttatccaaaagcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4398955 |
ctgggttatttcacaaaacccgcaaattaatccctcaacatcaagaatataccagcgacgaaaaaagatttttatgagtagaggccttatccaaaagcaa |
4398856 |
T |
 |
| Q |
112 |
ttgccaagaataattaatgacttttgaagggccttagagtcacgatctaaagttcattacttgataaagaagttatcgggggatctcg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4398855 |
ttgccaagaataattaatgacttttgaagggccttagagtcacgatctaaagttcattacttgataaagaagttatcgtgggatctcg |
4398768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University