View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4534_high_12 (Length: 312)
Name: NF4534_high_12
Description: NF4534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4534_high_12 |
 | |
|
| [»] scaffold0449 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 36 - 129
Target Start/End: Original strand, 4190 - 4286
Alignment:
| Q |
36 |
gatagccatggtgagggaggagaagaaatgagaaatgtggtagctgtagtcgatcataatgggagtaatgag---atttatatataccatttctttt |
129 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4190 |
gatagccatggtgagggaagagaagaaatgagaaatgtggtagctgtagtcgatcataatgggagtaatgagggaatttatatataccatttttttt |
4286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0449; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 197
Target Start/End: Original strand, 4312 - 4342
Alignment:
| Q |
167 |
tgagggatttttgagggaatttataccttta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4312 |
tgagggatttttgagggaatttataccttta |
4342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 299
Target Start/End: Original strand, 28103921 - 28103994
Alignment:
| Q |
227 |
agttctttgtggcttttagcgttgtt-cagaattgtgaggtgcagcggctgctactcggttgttcttctagcct |
299 |
Q |
| |
|
|||||| ||||| ||||||| ||||| |||||||||||||||| | ||||| | || |||| |||||||||||| |
|
|
| T |
28103921 |
agttctatgtggattttagcattgtttcagaattgtgaggtgcggaggctgatgcttggttattcttctagcct |
28103994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 298
Target Start/End: Original strand, 28101163 - 28101235
Alignment:
| Q |
227 |
agttctttgtggcttttagcgttgtt-cagaattgtgaggtgcagcggctgctactcggttgttcttctagcc |
298 |
Q |
| |
|
|||||| ||||| |||||||| |||| || ||||||||||| | | ||||||| || |||||||||||||||| |
|
|
| T |
28101163 |
agttctatgtggtttttagcgatgtttcaaaattgtgaggtacggaggctgctgcttggttgttcttctagcc |
28101235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University