View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4534_high_3 (Length: 393)
Name: NF4534_high_3
Description: NF4534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4534_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 112 - 380
Target Start/End: Original strand, 35202593 - 35202864
Alignment:
| Q |
112 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202593 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
35202692 |
T |
|
| Q |
212 |
ttcaattctacaagagtttcaagttcttcttctggttatgatcatctt---cagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202693 |
ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg |
35202792 |
T |
|
| Q |
309 |
tagttaatcttaatcatcatgatgattacagaaatgggtttggttcaaataataacaactacagttccatct |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202793 |
tagttaatcttaatcatcatgatgattacagaaatgggtttggttcaaataataacaactacagttccatct |
35202864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 2 - 85
Target Start/End: Original strand, 35202489 - 35202572
Alignment:
| Q |
2 |
aatcactcctcttcaaatattgatactgctactgcttctccttcttcttcaactcctactagtgctaattcaaaccctccttct |
85 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35202489 |
aatcactcttcttcaaatattgatactgctactgcttctccttcttcttcaactcctaatagtgctaattcaaaccctccttct |
35202572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University