View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4535-Insertion-10 (Length: 305)
Name: NF4535-Insertion-10
Description: NF4535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4535-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 11791143 - 11791054
Alignment:
| Q |
8 |
attatttcatatttgtgtacattgtatatatggagatttcattcatgtacacaaatatttactgacatgaaatctcccacttaccttttt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11791143 |
attatttcatatttgtgtacattgtatatatggagatttcatttatgtacacaaatatttactgacatgaaatctcccacttaccttttt |
11791054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 139 - 305
Target Start/End: Complemental strand, 11791052 - 11790880
Alignment:
| Q |
139 |
gtgtacattgaatatttatttatttttatgtacaaggatgtttgaaaatgaaatctcccac------------------catttcttcttaagattcata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11791052 |
gtgtacattgaatatttatttatttttatgtacaaggatgtttgaaaatgaaatctcccacttacctttctgataagaacatttcttcttaagattcata |
11790953 |
T |
|
| Q |
221 |
tgtactgattctctttccagttatctagcttagtaacttgtacgattcaatgtatccatatacttttcaatttttgtttaaactt |
305 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11790952 |
tgtactgattctctttccagt------------taacttttacgattcaatgtatccatatacttttcaatttttgtttaaactt |
11790880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University