View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4535_high_8 (Length: 211)
Name: NF4535_high_8
Description: NF4535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4535_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 45723882 - 45723692
Alignment:
| Q |
16 |
tgagatgaatataatgtttatattaagcttgatcgttatcgatacaagaaactatttgggttctgaatatattagcattgacaacgatacatgattgttc |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45723882 |
tgagaagaatataatgtttatattaagcttgatcgttatcgatacaagaaactatttgggttctgaatatattagcattgacaacgatacatgattgttc |
45723783 |
T |
 |
| Q |
116 |
atgtttctgcctatagtccttcgtt--------ggatgagttgccacaatcaggaccacctctaaagctcttacttagtttcatgttattg |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45723782 |
atgtttctgcctatagtccttcgttggatacttggatgagttgccacaatcaggaccacctctaaagctcttacttagtttcatgttattg |
45723692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University