View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4535_low_5 (Length: 249)
Name: NF4535_low_5
Description: NF4535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4535_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 5982397 - 5982594
Alignment:
| Q |
15 |
caaaggagcaacaaaatgcatgaccaaaataacatgtttgattttggtaatcaacatgcacaaccacgaccggctgctggacaccaacacgcgcaaccac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982397 |
caaaggagcaacaaaatgcatgaccaaaataacatgtttgattttcgtaatcaacatgcacaaccacgaccggctgctggacaccaacacgcgcaaccac |
5982496 |
T |
 |
| Q |
115 |
caccgactgctggaaaccatcgcgcacccccaccaccatttgctggatatcaacccggaccccaaccaccgtttgctggatatcgaccaccgccacca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982497 |
caccgactgctggaaaccatcgcgcacccccaccaccatttgctggatatcaacccggaccccaaccaccgtttgctggatatcgaccaccgccacca |
5982594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University