View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4535_low_6 (Length: 247)
Name: NF4535_low_6
Description: NF4535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4535_low_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 1737732 - 1737953
Alignment:
| Q |
18 |
atttagtacaaaatactgtaaaattacaactatagtcatgctatagcactgttgcgtagcggattcggaacaaatcgctatttctttgtgatccgcaatc |
117 |
Q |
| |
|
|||||||||||||||| ||||||| | | |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
1737732 |
atttagtacaaaataccgtaaaataa----tgtagtcatgctatagcattgttgcgtagcggattcggaacaaatcgctgtttctttgtgatccgaaatc |
1737827 |
T |
 |
| Q |
118 |
gacaaaatatgagtatcatgcagtgagttgttggattttgaaatataatgatattagagttgtttgtatattaggttatcgatctgttgatgaaaatatt |
217 |
Q |
| |
|
|| |||||||||||||| |||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1737828 |
gaaaaaatatgagtatcttgcagtgagtagttggattttgaagtataatgacattagagttgtttgtatattaggtt----atctgttgatgaaaatatt |
1737923 |
T |
 |
| Q |
218 |
ttcttgactgattattttacttgagaaatt |
247 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |
|
|
| T |
1737924 |
ttcttgactggttattttacttaagaaatt |
1737953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 70
Target Start/End: Complemental strand, 13125396 - 13125346
Alignment:
| Q |
20 |
ttagtacaaaatactgtaaaattacaactatagtcatgctatagcactgtt |
70 |
Q |
| |
|
||||||||||||| ||| |||| ||| ||||||| |||||||||||||||| |
|
|
| T |
13125396 |
ttagtacaaaatattgtcaaataacagctatagtgatgctatagcactgtt |
13125346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University