View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536-Insertion-3 (Length: 540)
Name: NF4536-Insertion-3
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 496; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 496; E-Value: 0
Query Start/End: Original strand, 33 - 540
Target Start/End: Complemental strand, 56099205 - 56098698
Alignment:
| Q |
33 |
attattattattattaccatccctcatcatataagttggtgcagcattaccataataccctccatttggatgaccgatatgaaactgtgggacaaacccc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56099205 |
attattattattattaccatccctcatcatataagttggtgcagcattaccataataccctccatttggatgaccgatatgaaactgtgggacaaacccc |
56099106 |
T |
|
| Q |
133 |
cctaaatttccatattccatacccctctttcccaaaggttcaactctcattgaggtacgatcaccttcaagctcacgataacgatgaaggtacattgtta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56099105 |
cctaaatttccatattccatacccctctttcccaaaggttcaactctcattgaggtacgatcaccttcaagctcacgataacgatgaaggtacattgtta |
56099006 |
T |
|
| Q |
233 |
gaggttcaatgtaatcatcaaaaccaagcttactcatagcctaaagcacatcttctgcagttattgtcttcctttgctctctctgacaacgttcattggc |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56099005 |
gaggttcaatgtaatcatcaaaaccaagcttactcatagcccaaagcacatcttctgcagttattgtcttcctttgctctctctgacaacgttcattggc |
56098906 |
T |
|
| Q |
333 |
ttctccagttatgaagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatgtggtggtagaattttgcgcatg |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
56098905 |
ttctccagttatgaagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatgtggtggtagaatcttgcgcatg |
56098806 |
T |
|
| Q |
433 |
atccttatcacatttgcaattggcataaaacggtcttgttccctcacaatgcattcattgtcttgttctgttccattgttgttctgttctcctacttgct |
532 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
56098805 |
atccttatcacatttgcaattggcataaaacggtcttgttccctcacaatgcattcattgtcttgttctgtaccattgttgttctgttctcctacttgct |
56098706 |
T |
|
| Q |
533 |
gcctcgtg |
540 |
Q |
| |
|
|||||||| |
|
|
| T |
56098705 |
gcctcgtg |
56098698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 389
Target Start/End: Complemental strand, 9722763 - 9722705
Alignment:
| Q |
331 |
gcttctccagttatgaagctgatgtactcagacacacactcttggattgtttcttttgc |
389 |
Q |
| |
|
||||||||||||||||| ||||| |||| || ||||||||||| | |||||||||||| |
|
|
| T |
9722763 |
gcttctccagttatgaaactgataaactctgatacacactcttgtactgtttcttttgc |
9722705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University