View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536-Insertion-6 (Length: 320)
Name: NF4536-Insertion-6
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536-Insertion-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 173 - 294
Target Start/End: Original strand, 1237748 - 1237869
Alignment:
| Q |
173 |
aaatgagataggaatgtcgttggctacaaacatcttaacaagttcattttggcaagcttcttggtcaaacttgttaaatttctgccttttgcttccatca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
1237748 |
aaatgagataggaatgtcgttggctacaaacatcttaacaagttcattttggcaagcttcttggtcaaacttgttagatttttgccttttgcttccatca |
1237847 |
T |
 |
| Q |
273 |
ctttgctcatctgtaaagtgat |
294 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1237848 |
ctttgctcatctgtaaagtgat |
1237869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University