View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536-Insertion-8 (Length: 221)
Name: NF4536-Insertion-8
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 221
Target Start/End: Original strand, 1356945 - 1357159
Alignment:
| Q |
7 |
aacctcttcatgttgtcatgtttccatggatagccatgggacacatgtacccatgttttgaggtttccaagattctttcacaaaatggtcactttgtcac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1356945 |
aacctcttcatgttgtcatgtttccatggatagccatgggacacatgtacccatgttttgaggtttccaagattctttcacaaaatggtcactttgtcac |
1357044 |
T |
|
| Q |
107 |
actcatatctactccttcaatcatagatcgtcttcctaaactctcacaaaccctttcaccatttgttaatctcatcaaacttcccttatcatcttacatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357045 |
actcatatctactccttcaatcatagatcgtcttcctaaactctcacaaaccctttcaccattttttaatctcatcaaacttcccttatcatcttacatt |
1357144 |
T |
|
| Q |
207 |
gacaaaaaccatctt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1357145 |
gacaaaaaccatctt |
1357159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 12845695 - 12845785
Alignment:
| Q |
9 |
cctcttcatgttgtcatgtttccatggatagccatgggacacatgtacccatgttttgaggtttccaagattctttcacaaaatggtcact |
99 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||| ||||||||||| ||||| | ||||||| | ||||||||||| | ||||| ||||||| |
|
|
| T |
12845695 |
cctcttcatgttgtaatggttccatggctagctatgggacacatatacccttattttgagttggccaagattcttgctcaaaagggtcact |
12845785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University