View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536-Insertion-9 (Length: 157)
Name: NF4536-Insertion-9
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536-Insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 9e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 9e-56
Query Start/End: Original strand, 7 - 141
Target Start/End: Complemental strand, 11746382 - 11746253
Alignment:
| Q |
7 |
aaaaatgtggtcaaatactattgttgcataaacaacatgaaaacattaacctcatatttagaacacataatggttatataatcacagagagacaacatat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11746382 |
aaaaatgtggtcaaatactattgttgcataaacaacatgaaaacattaacctcatatttagaacacataatggttatataatcac----agacaacatat |
11746287 |
T |
 |
| Q |
107 |
tgcttgtaaaggtgtaaactttccttctacttcaa |
141 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11746286 |
tgcttgtaaaggtgt-aactttccttctacttcaa |
11746253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University