View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536_high_12 (Length: 210)
Name: NF4536_high_12
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 109
Target Start/End: Complemental strand, 29257698 - 29257605
Alignment:
| Q |
16 |
atgaacaaacagaaattggtattgagataaatcatttgaactgctaaaaatgggattttattacttagcacagtggtttaatgtaatcatacat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29257698 |
atgaacaaacagaaattggtattgagataaatcctttgaactgctaaaaatgggattttattacttagcacagtggtttaatgtaatcatacat |
29257605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University