View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536_high_13 (Length: 209)
Name: NF4536_high_13
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 3 - 202
Target Start/End: Complemental strand, 2331887 - 2331691
Alignment:
| Q |
3 |
aaaataaataataaaacctgccaaaccgccattaatccaaatcatttttaaacgacaatgtttaggtacattcatgtgaagaactgagcgaatagtgtgc |
102 |
Q |
| |
|
||||||||| || ||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
2331887 |
aaaataaattattaaaactgcccaaccgccattaatccaaatcatttttaaacgacaatgtttaggtgcattcatgtgaaaaactgagcgaatagtgtgt |
2331788 |
T |
 |
| Q |
103 |
agggaacgatacctaagtattctcctttcttgtgttggttttcccttttaactgtttttcaccattattggtggtgatcattgttgtttcttagtattat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2331787 |
agggaacgatacctaagtattctcctttcttgtgttggttttcccttttaactgtttttcacc---attggtggtgatcattgttgtttcttagtattat |
2331691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University