View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536_high_7 (Length: 256)
Name: NF4536_high_7
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536_high_7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 256
Target Start/End: Original strand, 40771931 - 40772167
Alignment:
| Q |
20 |
atgtaattgttgtgatatgtgtaatacatactttgatcaactgaagaagtagcatgatcactcacgacacgctcttgtttaacaacactgcttgaagttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40771931 |
atgtaattgttgtgatatgtgtaatacatactttgatcaactgaagaagtagcatgatcactcacgacacgctcttgtttaacaacactgcttgaagttc |
40772030 |
T |
|
| Q |
120 |
cttcattccccggttccttttcttcaaggaagtaggaaaactctcgaggttcagattcagattgaggtagtggagttagggtgtcaactaactctaattg |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40772031 |
cttcgttccccggttccttttcttcaaggaagtaggaaaactctcgaggttcagattcagattgaggtagtggagttagggtgtcaactaactctaattg |
40772130 |
T |
|
| Q |
220 |
tttgtttttcgattcttccataatgtatctctagggt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40772131 |
tttgtttttcgattcttccataatgtatttctagggt |
40772167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University