View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536_high_8 (Length: 255)
Name: NF4536_high_8
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 19 - 142
Target Start/End: Complemental strand, 2332288 - 2332167
Alignment:
| Q |
19 |
atagattcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtcgtct |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2332288 |
atagatgcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccat--gttttccacattcaaaccagaaattttatttcgccgtct |
2332191 |
T |
|
| Q |
119 |
tctgatgatggcctgcgtatataa |
142 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
2332190 |
tctgatgatggcctgcgtgtataa |
2332167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 225 - 255
Target Start/End: Complemental strand, 2332085 - 2332055
Alignment:
| Q |
225 |
ttgcttatggcttttgcacatataaaacgtt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2332085 |
ttgcttatggcttttgcacatataaaacgtt |
2332055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University