View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4536_low_14 (Length: 240)
Name: NF4536_low_14
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4536_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 42662899 - 42663067
Alignment:
| Q |
1 |
ataacagaacctagcaataaggagaaaggctttggctcctcctggtagatcatgaagttccaaaattgacttctcactgtcacttggtatatctttcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662899 |
ataacagaacctagcaataaggagaaaggctttggctcctcctggtagatcatgaagttccaaaattgacttctcactgtcacttggtatatctttcatg |
42662998 |
T |
|
| Q |
101 |
aaacgttccagttctttacttcttgatatcagtggaaactggtaataatacaagaaattaagggtttaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42662999 |
aaacgttccagttctttacttcttgatatcagtggaaactggtaataatacaagaaattaagggtttaa |
42663067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 42663129 - 42663168
Alignment:
| Q |
183 |
catatatatgagatactcttgatattttatgtattaaact |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42663129 |
catatatatgagatactcttgatattttatgtattaaact |
42663168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University