View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4536_low_16 (Length: 210)

Name: NF4536_low_16
Description: NF4536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4536_low_16
NF4536_low_16
[»] chr1 (1 HSPs)
chr1 (16-109)||(29257605-29257698)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 109
Target Start/End: Complemental strand, 29257698 - 29257605
Alignment:
16 atgaacaaacagaaattggtattgagataaatcatttgaactgctaaaaatgggattttattacttagcacagtggtttaatgtaatcatacat 109  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29257698 atgaacaaacagaaattggtattgagataaatcctttgaactgctaaaaatgggattttattacttagcacagtggtttaatgtaatcatacat 29257605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University