View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4537_high_1 (Length: 390)
Name: NF4537_high_1
Description: NF4537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4537_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 19873482 - 19873418
Alignment:
| Q |
24 |
ggcccgatgtggttagtgttaattgtggttttgacagttactaatttgaagaccattttaattttc |
89 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
19873482 |
ggcctgatgtggttagtgttaattgtggttt-gagagttactaatttgaagaccatttttattttc |
19873418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 19873342 - 19873299
Alignment:
| Q |
168 |
ttttaagctttctttattcttctcaaagtaaatgtatatattat |
211 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19873342 |
ttttaagttttcttttttcttctcaaagtaaatgtatatattat |
19873299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 61 - 96
Target Start/End: Complemental strand, 44640074 - 44640039
Alignment:
| Q |
61 |
ttactaatttgaagaccattttaattttcaaatgta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44640074 |
ttactaatttgaagaccattttaattttctaatgta |
44640039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University