View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4537_high_2 (Length: 358)
Name: NF4537_high_2
Description: NF4537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4537_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 13619010 - 13618815
Alignment:
| Q |
16 |
aattttaataaccctaattacaccctagagaggttttaaggtttgggtttaagactatgttaccttagattttacccaaaagagagacacttgaatccct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13619010 |
aattttaataaccctaattacaccctagagaggttttaaggtttgggtttaagactatgttaccttagattttacccaaaagagagatacttgaatccct |
13618911 |
T |
|
| Q |
116 |
aattttaacttgattttgcaacttccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatgaaggttgcagctccaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13618910 |
aattttaacttgattttgcaacttccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatggaggttgcagctccaa |
13618815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 36 - 207
Target Start/End: Original strand, 52041736 - 52041907
Alignment:
| Q |
36 |
caccctagagaggttttaaggtttgggtttaagactatgttaccttagattttacccaaaagagagacacttgaatccctaattttaacttgattttgca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52041736 |
caccctagagaggttttaaggtttgggtttaagactatgttaccttagattttatccaaaagagagatacttgaatccctaattttaacttgattttgca |
52041835 |
T |
|
| Q |
136 |
acttccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatgaaggttgcagct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52041836 |
acttccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatggaggttgcagct |
52041907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 161; Significance: 8e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 36 - 208
Target Start/End: Original strand, 1689374 - 1689546
Alignment:
| Q |
36 |
caccctagagaggttttaaggtttgggtttaagactatgttaccttagattttacccaaaagagagacacttgaatccctaattttaacttgattttgca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1689374 |
caccctagagaggttttaaggtttgggtttaagactatgttaccttagattttatccaaaagagagatacttgaatccctaattttaacttgattttgca |
1689473 |
T |
|
| Q |
136 |
acttccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatgaaggttgcagctc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1689474 |
acttccatgatggctatagcttcttcaatggtgacttctcctttttctttactgtagatggaggttgcagctc |
1689546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 111 - 182
Target Start/End: Original strand, 25749095 - 25749166
Alignment:
| Q |
111 |
tccctaattttaacttgattttgcaacttccatgatggctatagcttcttcaatggtgacttctcctttttc |
182 |
Q |
| |
|
||||||||||||||||||||||| || |||||| ||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
25749095 |
tccctaattttaacttgattttgtaatttccataatgactatagcttcttcaatggtagcttcccctttttc |
25749166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 90
Target Start/End: Original strand, 25749040 - 25749094
Alignment:
| Q |
34 |
tacaccctagagaggttttaaggtttgggtttaagactatgttaccttagattttac |
90 |
Q |
| |
|
||||| ||||||||||||| || |||||| | ||||||||||||||||||||||||| |
|
|
| T |
25749040 |
tacactctagagaggttttgag-tttgggat-aagactatgttaccttagattttac |
25749094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 18448614 - 18448564
Alignment:
| Q |
28 |
cctaattacaccctagagaggttttaaggtttgggtttaagactatgttacct |
80 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
18448614 |
cctaagtacaccctagagagg-tttaaagtttggg-ttaagactatgttacct |
18448564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University