View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4537_low_4 (Length: 355)
Name: NF4537_low_4
Description: NF4537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4537_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 146 - 347
Target Start/End: Complemental strand, 26986912 - 26986710
Alignment:
| Q |
146 |
ttgaaggaactgaaaaaagttattagtgactcgtttagtatatnnnnnnn-tgttgaattggagggcattcataaccaaaacaaagataacttgaaacta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26986912 |
ttgaaggaactgaaaaaagttattagtgactcgtttagtatataaaaaaaatgttgaattggagggcattcataaccaaaacaaagataacttgaaacta |
26986813 |
T |
 |
| Q |
245 |
atttgattaagctagtcaaaagaaaacatatattactatctcaatttaaatttttacgcactcaaacatatactaaatttttggtgtaacaatgagatat |
344 |
Q |
| |
|
||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
26986812 |
atttgattaagttggtcaaaagaaaacaaatattactatctcaatttaaatttttacgcactcaaacatataccaaatttctggtgtaacaatgagatat |
26986713 |
T |
 |
| Q |
345 |
gat |
347 |
Q |
| |
|
||| |
|
|
| T |
26986712 |
gat |
26986710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 26987047 - 26986997
Alignment:
| Q |
13 |
tgagatgaatagttattgaggaagaggtttttagaagcacactttttcctc |
63 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26987047 |
tgagaagaatagttattgaggaagaggtttttagaagcacactttttcctc |
26986997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University