View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4538_low_18 (Length: 241)
Name: NF4538_low_18
Description: NF4538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4538_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 20816289 - 20816512
Alignment:
| Q |
2 |
gcatgtcgaagaatatccaatgaagtttcaattcggggggacacggtgggccctgtgaaagttgtaccgttgtattctactcttcccccggctatgcaac |
101 |
Q |
| |
|
|||||||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20816289 |
gcatgtcgcaaaatatccaatgaagttgcaattcggggggacacggtgggccctgtgaaagttgtaccgttgtattctactcttcccccggctatgcaac |
20816388 |
T |
|
| Q |
102 |
acaggatttttgagccagctccacctccagttagagagggaggccttcctggaaggaagattttggtatcaacaaacatagcagaaacttcattgaccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20816389 |
acaggatttttgagccagctccacctccagttagagagggaggccttcctggaaggaagattttggtatcaacaaacatagcagaaacttcattgaccat |
20816488 |
T |
|
| Q |
202 |
cgatggtatagtctatgttgttga |
225 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
20816489 |
caatggtatagtctatgttgttga |
20816512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 37 - 226
Target Start/End: Complemental strand, 38779821 - 38779632
Alignment:
| Q |
37 |
gggggacacggtgggccctgtgaaagttgtaccgttgtattctactcttcccccggctatgcaacacaggatttttgagccagctccacctccagttaga |
136 |
Q |
| |
|
||||||| ||||||||||||||||| || || || ||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
38779821 |
gggggaccaggtgggccctgtgaaagccgtgccattatattctactcttcccccagctatgcaacagaagatttttgagccagctccacctccagttaag |
38779722 |
T |
|
| Q |
137 |
gagggaggccttcctggaaggaagattttggtatcaacaaacatagcagaaacttcattgaccatcgatggtatagtctatgttgttgat |
226 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||| || |||||||||||||||||| ||||| |
|
|
| T |
38779721 |
gagggaggcccccctggaaggaagattgtggtatcaacaaacatagcagaaacttccttgacaattgatggtatagtctatgttattgat |
38779632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 33388771 - 33388592
Alignment:
| Q |
46 |
ggtgggccctgtgaaagttgtaccgttgtattctactcttcccccggctatgcaacacaggatttttgagccagctccacctccagttagagagggaggc |
145 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| |||||||| |||||||| || | |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33388771 |
ggtgggccctgtgaaagtgttatcactgtattctacccttcccccagctatgcagcagaagatttttgagccagctccgcctccagttaaggagggaggc |
33388672 |
T |
|
| Q |
146 |
cttcctggaaggaagattttggtatcaacaaacatagcagaaacttcattgaccatcgatggtatagtctatgttgttga |
225 |
Q |
| |
|
|| |||||||| |||||| |||||||||||||||||||||||||||| ||||| || ||||||||||| |||||| |||| |
|
|
| T |
33388671 |
ctccctggaagaaagattgtggtatcaacaaacatagcagaaacttctttgactattgatggtatagtatatgttattga |
33388592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University