View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4538_low_21 (Length: 201)
Name: NF4538_low_21
Description: NF4538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4538_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 432280 - 432167
Alignment:
| Q |
1 |
acaatccacaacccgttttcatttttctctcttgcattgtttcactacttgccacatttcactcagattttcattttcttcttcagttgttttactattc |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
432280 |
acaatccacaacctgttttcatttttctctcttgcattgtttcactacttgccacatttcactcagattttcattttcttcttcacctgttttactattc |
432181 |
T |
|
| Q |
101 |
acttaaccctaatt |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
432180 |
acttaaccctaatt |
432167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University