View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4540-Insertion-10 (Length: 442)
Name: NF4540-Insertion-10
Description: NF4540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4540-Insertion-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 8 - 233
Target Start/End: Original strand, 12273834 - 12274059
Alignment:
| Q |
8 |
ttcagctggtaggtgtcaaatgattgcttgaatttttatgatatgcttcaagatattgttgtattgataagcttgatttttatgatattaacaagtttca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12273834 |
ttcagctggtaggtgtcaaatgattgcttgaatttttatgatatgcttcaagatattgttgtattgataagcttgatttttatgatattaacaagtttca |
12273933 |
T |
|
| Q |
108 |
cttgttagttgctatgtataacaatgataattcggcttaataaagagaggtcatgaacatccaacatgtgtcggtatcagacaccaacataacttcgaca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12273934 |
cttgttagttgctatgtataacaatgataattcggcttaataaagagaggtcatgaacatccaacatgtgtcggtatcagacaccaacataactttgaca |
12274033 |
T |
|
| Q |
208 |
cacgcaacacaactagatatatattg |
233 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
12274034 |
cacgcgacacaactagatatatattg |
12274059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 331 - 442
Target Start/End: Original strand, 12274155 - 12274266
Alignment:
| Q |
331 |
ctaaagttgctatttgaatattgaatgaacactaacatattgcatatttttgcgaacagatgcacgcagaattccaagttctttctccgttggtgtccac |
430 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274155 |
ctaaaattgctatttgaatattgaatgaacactaacatattgcatatttttgcgaacagatgcacgcagaattccaagttctttctccgttggtgtccac |
12274254 |
T |
|
| Q |
431 |
cagagagactca |
442 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12274255 |
cagagagactca |
12274266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University