View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4540-Insertion-18 (Length: 179)
Name: NF4540-Insertion-18
Description: NF4540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4540-Insertion-18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 8 - 179
Target Start/End: Complemental strand, 24885301 - 24885130
Alignment:
| Q |
8 |
attcaagcccttccttatcgcactcgagctcagccaccctcttagtcaattcctctgcatatttgtgagtagcattaactattcctcgtacttggttagg |
107 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24885301 |
attcaagccctttcttatcgcgctcgagctcagccaccctcttagtcaattcctccgcatatttgtgagtagcattaactattcctcgtgcttggttagg |
24885202 |
T |
|
| Q |
108 |
gcctggatttctttgtctttatgagaaaacttcatgatcacacccatctaaatttcatgcttgtccttgtaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24885201 |
gcctggatttctttgtctttatgagaacactccataatcacacccatctaaatttcatgcttgtccttgtaa |
24885130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University