View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4540-Insertion-19 (Length: 70)
Name: NF4540-Insertion-19
Description: NF4540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4540-Insertion-19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 53118251 - 53118313
Alignment:
| Q |
8 |
attgtaatccaatttctgaactatttttatgttcaatatctgttaagcaactccaaaccatgc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118251 |
attgtaatccaatttctgaactatttttatgttcaatatctgttaagcaactccaaaccatgc |
53118313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University