View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4541_high_12 (Length: 399)
Name: NF4541_high_12
Description: NF4541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4541_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 15 - 273
Target Start/End: Complemental strand, 2161045 - 2160791
Alignment:
| Q |
15 |
gaaacgatagaaacatgtaaagtgtcatccaggtcaataaaatttgatgagtgccattgtagcgaccattcaaaacccaccaattcttctcattctgtca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2161045 |
gaaacgatagaaacatgtaaagtgtcatccaggtcaataaaatttgatgagtgccattgtagcgaccattcaaaacccaccgattcttctcattctgtca |
2160946 |
T |
 |
| Q |
115 |
agtgcaaatgctgcatcgaatccgaatcccaaactcaaccttatctcctcaattttgctggcatataccaaagtctcacacacaaaaatactcccagttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2160945 |
agtgcaaatgctgcatcgaatccgaatcccaaactcaaccttatctcctcaattttgctggcatataccaaagtctcacacacaaaaatactcccagttg |
2160846 |
T |
 |
| Q |
215 |
gtacgtccaaatgaggtcttgggctacccacccaaatccggaagctccagctggaaaaa |
273 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
2160845 |
gtacgtccaaatgaggtcttgggtt----acccaaatccggaagctccagctggaaaaa |
2160791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 268 - 384
Target Start/End: Complemental strand, 2160748 - 2160632
Alignment:
| Q |
268 |
gaaaaatactcaccattctgattttgtaatgccctcaatgaatttcttatgttgctatatgggttaggtgtctctcattattgtgcctttggtatccact |
367 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2160748 |
gaaaaatactcaccattctggttttgtaatgccctcaatgaatttcttatgttgctatatgggttaggtgtctatcattattgtgcctttggtatccact |
2160649 |
T |
 |
| Q |
368 |
cttgttcttttacaatt |
384 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2160648 |
cttgttcttttacaatt |
2160632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University