View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4541_high_6 (Length: 448)
Name: NF4541_high_6
Description: NF4541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4541_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 17 - 440
Target Start/End: Complemental strand, 30874068 - 30873645
Alignment:
| Q |
17 |
agtaagtagtggttgtgatgtgtttgactctgtggctacctatgcaagaaagcgtcaaagagggatctgtgtccttagtgggagtggaacagtcactaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874068 |
agtaagtagtggttgtgatgtgtttgactctgtggctacttatgcaagaaagcgtcaaagagggatctgtgtccttagtgggagtggaacagtcactaac |
30873969 |
T |
|
| Q |
117 |
gtgaccctgcgacagccagctgccgcaggatctgtagtgactttacacggaaggtttgaaatactttctttgtccggatcgtttctaccaccaccagctc |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873968 |
gtgaccttgcgacagccagctgccgcaggatctgtagtgactttacatggaaggtttgaaatactttctttgtccggatcgtttctaccaccaccagctc |
30873869 |
T |
|
| Q |
217 |
ctccaggagctacaagtttgagtgtgttccttggcggaggccaaggtcaagttgtgggaggaaatgttgttggtcctttggttgcttctggaccggttat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873868 |
ctccaggagctacaagtttgagtgtgttccttggtggaggccaaggtcaagttgtgggaggaaatgttgttggtcctttggttgcttctggaccggttat |
30873769 |
T |
|
| Q |
317 |
tgtcatcgcttcatcttttacgaatgtagcgtatgagaggttaccgttggatgaagatgaatctcttcagatgcaacaagggcaatcatctgcaggtggt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873768 |
tgtcatcgcttcatcttttacgaatgtagcgtatgagaggttaccgttggatgaagatgaatctcttcagatgcaacaagggcaatcatctgcaggtggt |
30873669 |
T |
|
| Q |
417 |
ggtggcggtggcggtgatgatgtc |
440 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
30873668 |
ggtggcggtggcggtgatggtgtc |
30873645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University