View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4541_low_11 (Length: 407)
Name: NF4541_low_11
Description: NF4541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4541_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 163 - 390
Target Start/End: Complemental strand, 2432366 - 2432139
Alignment:
| Q |
163 |
tgatgaatgtgtactggaggtgtcgtagagcgtctacgaataaatgaatgtattagctatcttgatacaagcttaatgctcataaaaattatgggggtat |
262 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
2432366 |
tgataaatgtgtactagatgtgtcgtagagcgtctacgaataaaggaatgtattagctatcttgatagaagcttaatgctcatgaaaattatggtggtat |
2432267 |
T |
|
| Q |
263 |
tggtgttaaagacctcacgacctttaatttggtgaggcttagttatagtcaacggtggaaattcccagcacagattgattcattggtatcgaggcttttc |
362 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||| ||||| |||||||| |
|
|
| T |
2432266 |
tggttttaaagacctcacgacctttaatttggtgaggcttagttatattcaacggtggaaattccaaacacagattgattcatttgtatcagggcttttc |
2432167 |
T |
|
| Q |
363 |
aaatcacgatatttcccttaaagtactt |
390 |
Q |
| |
|
||| || | ||||||||| ||||||||| |
|
|
| T |
2432166 |
aaagcaggttatttccctcaaagtactt |
2432139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 75 - 150
Target Start/End: Complemental strand, 2435445 - 2435370
Alignment:
| Q |
75 |
ataatcaaatcagtggttgaggcaatccactcatatgtcatgaacatatttctcattcccactactattatcgatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2435445 |
ataatcaaatcagtggttgaggcaatccactcatatgtcaagaacatatttctcattcccactactattattgatg |
2435370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University