View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4541_low_13 (Length: 398)
Name: NF4541_low_13
Description: NF4541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4541_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 10 - 376
Target Start/End: Complemental strand, 15428665 - 15428299
Alignment:
| Q |
10 |
attattctagaaagaatggacagaaacgtatgtcgctagggttagtgacactggaaattggaataaaattgattgagccattggaagacaagcagaaacg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15428665 |
attattctagaaagaatggacagaaacgtatgtcgctagggttggtgacactggaaattggaataaaattgattgagccattggaagacaagcagaaacg |
15428566 |
T |
 |
| Q |
110 |
agggttggtgtgattgattgtttgcatttttataataactacaattttatcacttatgattatgccattcaatcatcactctcacaaaacaacgacaaac |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15428565 |
agggttggtgtgattgattatttgcatttttataataactacagttttatcacttatgattatgccattcaatcatcactctcacaaaacaacgacaaac |
15428466 |
T |
 |
| Q |
210 |
tttgcaatttggtctgcagcgggtttagcgatcgtgtgtgaaataggaggggaggatcataacaacttgtgtgcctcacttatttcaaatgtctttgcta |
309 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15428465 |
cttgcaatttggtctgcagggggtttagcgatcgtgtgtgaaataggaggggaggatcataacaacttgtgtgcctcacttatttcaaatgtctttgcta |
15428366 |
T |
 |
| Q |
310 |
tcttattcacaaacagtttggtatttactcagctgatccattgcgtctatcagatcatttgtagttt |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15428365 |
tcttattcacaaacagtttggtatttactcagttgatccattgcgtctatcagatcatttgtagttt |
15428299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University