View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4541_low_18 (Length: 271)
Name: NF4541_low_18
Description: NF4541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4541_low_18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 26607758 - 26608018
Alignment:
| Q |
11 |
cacagagcaatatatagtgcatgtttagatcaacaaggaattaaatagaatcattgtgtgcaatcttgattttggcaaactttatactttagtgcttcta |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26607758 |
cacagaacaatatatagtgcatgtttagatcaacaaggaattaaatagaatcattgtgtgcaatcttgattttggcaaactttatactttagtgcttcta |
26607857 |
T |
 |
| Q |
111 |
ttcgcgagtttggatctgcttcgtttactaatgagtctagttttccagtttgttgcacaaatgtctgcacttgtcacaaaaaactttcaacggccaagat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26607858 |
ttcgcgagtttggatctgcttcgtttactaatgagtctagttttccagtttgttgcacaaatgtctgcacttgtcacaaaaaactttcaacggccaagat |
26607957 |
T |
 |
| Q |
211 |
taaaactttaaaaatcagcatttttctaatgtaaaaagagagtgaaaacgtttctcagttt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26607958 |
taaaactttaaaaatcagcatttttctaatgtaaaaagagagtgaaaacgtttctcagttt |
26608018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University